Get ready to groove as we spotlight some of the most unforgettable Bollywood dance moments that have defined the century so far! These electrifying performances feature powerhouse stars, catchy tunes, ...

Look to the west after sunset this week for a spectacular sight, as the razor-thin waxing crescent moon hangs low above the horizon with earthshine bathing its unlit surface in a soft, otherworldly ...

1. Cut beef steak lengthwise in half then crosswise into 1/8 to 1/4-inch thick strips. 2. Combine marinade ingredients in a medium bowl. Add beef and toss to coat. Cover and marinate in the ...

Today, March 20, marks the beginning of the Spring Equinox which is the perfect time to shift your attention to your garden and get it ready for the new season. If you don't know where to start but ...

A Virginia murder case is fueling a political fight over immigration enforcement, as the victim’s family and Republican officials blame Democratic Gov. Abigail Spanberger’s policies and a progressive ...

We carried out primer extension using total RNA prepared from NHK with primer 5′–ACAGTTTTGTGAGCCACCGTGTGGTTG–3′ for B2 or primer 5′–AGCAGGCTCTTTCGATCCCCAAGC–3′ for β-galactosidase as described 7. In ...

Add Yahoo as a preferred source to see more of our stories on Google. A Virginia murder case is fueling a political fight over immigration enforcement, as the victim’s family and Republican officials ...